KOBIC-Edu36 #
Find similar titles

제36회 KOBIC 차세대 생명정보학 교육 워크샵 데이터 과학을 위한 파이썬 기초

개요 #

일시: 2017-10-24 ~ 2017-10-25
장소: KT인재개발원 제1연수관 203호
내용: 프로그래밍 언어 파이썬 집중 단기 학습을 통해 생물정보 데이터 분석 실무 능력 습득
URL: http://kobicedu.labkm.net

강의 특징 #

이론과 실습 병행
첫째날 노트북에 직접 python 설치하여 실습 (서버에 원격 접속 (putty) 병행)
둘째날 개인 PC에 Jupyter 설치하여 실습
사전 준비 사항
- 실습시 개인 PC에 Anaconda 설치 (Anaconda_jupyter-설치방법.pdf)

강의 자료 (실습데이터 포함) #

주요 리소스 #

http://rosalind.info 생물정보 학습을 위한 파이썬 문제 풀이 사이트
http://nbviewer.jupyter.org/url/norvig.com/ipython/Probability.ipynb

교육 환경 #

원격 실습 서버 접속 방법 #

로컬컴퓨터에 파이썬을 설치하여 실습하거나 원격 서버에서 실습, 실습서버 원격접속 방법은 아래 참고

Windows #

Putty 프로그램 설치: Putty download page에서 Windows용 MSI 설치 파일 putty-version-installer.msi 다운로드 및 실행
Putty 프로그램 실행 후, 설정창에서 다음 입력 후 저장
1. Host Name: edu.kobic.re.kr
2. Saved Sessions: kobic33
kobic33 선택 후 Open 클릭하여 접속
login as: 부분에서 부여받은 아이디 입력
kobic@edu.kobic.re.kr`s password: 부분에서 비밀번호 입력
접속 성공!

Linux/OS X #

iTerm 프로그램 구동 후, 다음처럼 입력하여 접속 (kobic23 사용자라면,)

$ ssh kobic23@edu.kobic.re.kr

Jupyter 설치 방법 #

(Anaconda_jupyter-설치방법.pdf) 참고하여 설치

filezilla 설치: https://filezilla-project.org #

파이썬 참고 정보 #

파이썬 코딩 스타일 PEP 8
PEP 한글 번역 프로젝트
파이썬 코딩 스타일 한국어 정보 파이썬 코딩 컨벤션

Matplolib 한글폰트 설정 #

윈도우에서

from matplotlib import font_manager, rc
font_name  = font_manager.FontProperties(fname="c:/Windows/Fonts/malgun.ttf").get_name()
rc('font', family=font_name)

맥에서

matplotlib.font_manager.get_fontconfig_fonts()
krfont = {'family': 'AppleGothic', 'weight': 'bold', 'size': 10}
matplotlib.rc('font', **krfont)

리눅스에서

matplotlib.font_manager.get_fontconfig_fonts()
krfont = {'family': 'UnDotum', 'weight': 'bold', 'size': 10}
matplotlib.rc('font', **krfont)

연습문제 풀이 (첫째날) #

set_operation.py #

#!python
a = input("Set A: ")
b = input("Set B: ")
a_set = set(a.split())
b_set = set(b.split())

print()
print('Union --->', ' '.join(a_set | b_set))
print('Intersection -->', ' '.join(a_set & b_set))
print('Difference -->', ' '.join(a_set - b_set))

countseq.py #

#!python
seq = 'AGCTACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTCTCTGACAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCACCACCATCACCATTACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGGGTTGCCGATA'

numa = seq.count('A')
numg = seq.count('G')

print('Number of As:{}'.format(numa))
print('Number of Gs:{}'.format(numg))

if numa > numg:
    print("A is more than G")
elif numg > numa:
    print("G is more than A")
elif numg == numa:
    print("Same")

gugu.py #

#!python
for i in range(2, 10):
    for j in range(1, 10):
        print(i * j, end=" ")
    print('')

find75.py #

#!python
for n in range(1500, 2701):
    if (n % 7 == 0) and (n % 5 == 0):
        print(n)

starta_gene.py #

#!python
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for accession in accs:
    if accession.startswith('a'):
        print(accession)

printnum.py #

#!python
i = 0
while True:
    if i >= 10:
        break
    if i % 2 == 0:
        i += 1
        continue
    print(i)
    i += 1

whileseq.py #

#!python
seq = input('Enter sequence: ')
i = 0
counta = 0
countg = 0
countt = 0
countc = 0
others = 0

while i < len(seq):
    if seq[i] == 'A':
        counta += 1
    elif seq[i] == 'T':
        countt += 1
    elif seq[i] == 'G':
        countg += 1
    elif seq[i] == 'C':
        countc += 1
    else:
        others += 1

    if counta == 15:
        print('Found 15th A!')
        print('Number of As:{}'.format(counta))
        print('Number of Ts:{}'.format(countt))
        print('Number of Gs:{}'.format(countg))
        print('Number of Cs:{}'.format(countc))
        print('Number of others:{}'.format(others))

        print(seq[:i + 1])
        break
    i += 1

randomnum.py #

#!python
import random
number = random.randint(1, 20)

count = 0
while True:
    answer = int(input("Enter number: "))
    count += 1
    if number == answer:
        print("정답입니다! {}번만에 맞추셨군요!".format(count))
        break
    elif number > answer:
        print("{} 보다 큽니다!".format(answer))
    else:
        print("{} 보다 작습니다!".format(answer))

count.py #

#!python
import sys
f = open(sys.argv[1], 'r')
seq = f.read()
a = seq.count('A')
t = seq.count('T')
g = seq.count('G')
c = seq.count('C')

print a, c, g, t
f.close()

trans.py #

#!python
import sys

f = open(sys.argv[1], 'r')
seq = f.read()
rna = seq.replace('T', 'U')
print(rna)
f.close()

# 만일 rna서열을 파일로 쓰고 싶다면?
with open("rnaseq.txt", "w") as outfile:
    outfile.write(rna)

count_trans.py #

#!python
import sys

def countseq(seq):
    a = seq.count('A')
    t = seq.count('T')
    g = seq.count('G')
    c = seq.count('C')
    return (a, t, g, c)

def trans(seq):
    rna = seq.replace('T', 'U')
    return rna

f = open(sys.argv[1], 'r')
dna_seq = f.read()
(a, t, g, c) = countseq(dna_seq)
rna_seq = trans(dna_seq)

print(a, t, g, c)
print(rna_seq)
f.close()

compareseq1.py #

#!python
import sys

f = sys.stdin

maxseq = ''
maxname = ''
for line in f.readlines():
    name, seq = line.split(' ')
    if not maxname:
        maxname = name
        mexseq = seq
        continue
    if len(seq) > len(maxseq):
        maxname = name
        maxseq = seq
print("SEQUNCE NAME:", maxname)
print(maxseq)
f.close()

compareseq2.py #

#!python
import sys

f = open(sys.argv[1], 'r')

maxseq = ''
maxname = ''
for line in f.readlines():
    name, seq = line.split(' ')
    if not maxname:
        maxname = name
        mexseq = seq
        continue
    if len(seq) > len(maxseq):
        maxname = name
        maxseq = seq
print("SEQUNCE NAME:", maxname)
print(maxseq)
f.close()

hamm.py #

#!python
import sys

hamming_distance = 0
f = open(sys.argv[1], 'r')
seq1, seq2 = f.readlines()

for a, b in zip(seq1, seq2):
    if a != b:
        hamming_distance += 1
print(hamming_distance)
f.close()

연습문제 풀이 (둘째날) #

word frequency (임의의 파일을 읽어 자주 출현하는 단어 top 20개를 빈도와 함께 출력) #

#!python
import sys

d = {}

for line in sys.stdin:
    words = line.split()
    for word in words:
        if word in d:
            d[word] += 1
        else:
            d[word] = 1

for word, frequency in sorted(d.items(), 
        key=lambda x: x[1], reverse=True)[:20]:
    print(word, frequency)

구구단 함수를 이용하여 #

#!python
def print_gugu(x):
    for y in range(1, 10):
        print("{} x {} = {}".format(x, y, x * y))

n = input("Please insert an integer: ")
print_gugu(int(n))

명령행 인터페이스 #

#!python
import sys
import argparse

parser = argparse.ArgumentParser()
parser.add_argument("-t", "--top", help="상위 항목 표시수",
        type=int, default=20)
parser.add_argument("-c", "--case_insensitive", help="대소문자 구분안함",
        default=False, action="store_true")
args = parser.parse_args()

d = {}

for line in sys.stdin:
    words = line.split()
    for word in words:
        if args.case_insensitive:
            word = word.lower()
        if word in d:
            d[word] += 1
        else:
            d[word] = 1

for word, frequency in sorted(d.items(),
        key=lambda x: x[1], reverse=True)[:args.top]:
    print(word, frequency)

matplotlib 연습문제 5 #

#!python
import matplotlib.pyplot as plt
%matplotlib inline

data = pd.read_csv('weight.csv')

# figure, subplot 생성
fig, axes = plt.subplots(3,1, figsize=(5,20))

# 국가별 체충의 boxplot 그리기
data.boxplot(column='Weight', by='Country', ax=axes[0])

#  체중의 histogram 그리기
data['Weight'].hist(ax=axes[1], color='gray', bins=20, range=(0,120))

# 성별로 pie차트 그리기
data['Sex'].value_counts().plot(ax=axes[2], kind='pie')

plt.subplots_adjust(hspace=0.5)

#ex5.png에 저장
plt.savefig(‘ex5.png’)

matplotlib 연습문제 6 #

#!python
import pandas as pd
import matplotlib.pyplot as plt
%matplotlib inline

def get_len(row):
    return row.end - row.start

# figure, subplot 생성
fig, axes = plt.subplots(2,1)

genes_df = pd.read_table(
    "data/rice_locus.gff",
    names=['chr', 'source', 'type', 'start', 'end',
           'score', 'strand', 'phase', 'attrs'],
)
genes_df['length'] = genes_df.apply(get_len, axis=1)

# 0~20000 length
filtered1 = genes_df[(genes_df['chr'] == 'chr01') & (genes_df['length'] < 20000)]
filtered1['length'].hist(bins=40, ax=axes[0])

# 20000~ length
filtered2 = genes_df[(genes_df['chr'] == 'chr01') & (genes_df['length'] >= 20000)]
filtered2['length'].hist(bins=40, ax=axes[1])

plt.savefig('rice_gene_len.png')

Suggested Pages #

0.025 몬산토
0.025 컴파일
0.025 일반화
0.025 Java
0.025 PyPy
0.025 Jython
0.025 CPython
0.025 C#
0.025 귀도 반 로섬
0.025 과학
More suggestions...

Table of Contents

개요 #

강의 특징 #

강의 자료 (실습데이터 포함) #

주요 리소스 #

교육 환경 #

원격 실습 서버 접속 방법 #

Windows #

Linux/OS X #

Jupyter 설치 방법 #

filezilla 설치: https://filezilla-project.org #

파이썬 참고 정보 #

Matplolib 한글폰트 설정 #

연습문제 풀이 (첫째날) #

set_operation.py #

countseq.py #

gugu.py #

find75.py #

starta_gene.py #

printnum.py #

whileseq.py #

randomnum.py #

count.py #

trans.py #

count_trans.py #

compareseq1.py #

compareseq2.py #

hamm.py #

연습문제 풀이 (둘째날) #

word frequency (임의의 파일을 읽어 자주 출현하는 단어 top 20개를 빈도와 함께 출력) #

구구단 함수를 이용하여 #

명령행 인터페이스 #

matplotlib 연습문제 5 #

matplotlib 연습문제 6 #

Suggested Pages #