Skip to content

RepeatModeler #

Find similar titles

3회 업데이트 됨.

Edit

Structured data

Category
Software

Description #

RepeatModeler는 de novo 방식으로 Repeat family를 탐색하고 모델링하는 패키지로 RECONRepeatScout의 두 프로그램을 이용한다. Human과 같이 model organism이 아닌 신규 분석 유전체의 경우 RepBase와 같이 알려진 repeat library가 없으므로 RepARK 또는 RepeatModeler와 같은 프로그램을 이용하여 종 특이적인 repeat library를 규명할 수 있다. 이렇게 얻어진 repeat library 정보는 RepeatMasker 프로그램에 의해 해당 반복서열을 마스킹하는 데 이용될 수 있다.

Install #

Requirement #

  1. Perl, version 5.8.8
  2. RepeatMasker, version open-4.0.5+ & Libraries
  3. RECON - De Novo Repeat Finder, version 1.0.8
  4. RepeatScout - De Novo Repeat Finder, version 1.0.5
  5. TRF - Tandem Repeat Finder, version 4.0.4
  6. RepeatModeler/Search engine
    1. RMBlast
    2. WUBlast/ABBlast

Configuration #

$ perl ./configure

Usage #

Format sequences #

$ ./BuildDatabase -name <database name> -engine <abblast|wublast|ncbi> <input sequence - fasta file> -dir <directory containing fasta files (*.fa/*.fasta)>
$ ./BuildDatabase -name Test -engine ncbi Test.fasta

Model repetitive DNA #

$ ./RepeatModeler -database <database name> -engine <abblast|wublast|ncbi> -pa <number of threads>
$ ./RepeatModeler -database Test -engine ncbi -pa 27

Output #

  1. RM_[PID].[DATE]/consensi.fa.classified

    $ head RM_32148.MonSep141249552015/consensi.fa.classified
    >rnd-1_family-164#LINE/Penelope ( RepeatScout Family Size = 131, Final Multiple Alignment Size = 100, Localized to 1619 out of 2780 contigs )
    TGAAAGCGGATAAAGGNAATTGTACGATTGTCAGTAACAAAAGTGATTAC
    GAAGAAAAA ...
    

    Incoming Links #

    Related Bioinformaticses #

0.0.1_20240214_1_v81